SNP details
ChrY position:15491364 (+strand)
Reference sequence (100bp): TTTTTAGATTCATCAGAGAAGTGGGGGTCACAGCACAAGTCAACAAACCC
 A 
AAATGGAGGAAAATGACAGACCAATGCAGGGAGTAAGGACTGGCCAGAGC
(15491313-15491414)