SNP details
ChrY position:16214089 (+strand)
Reference sequence (100bp): CTCCATCTTTCTAAGCAAATAAGAGATTTAACTTAATATTGCAGATTAGA
 G 
CCAAGATGGCTGAATAGGAACAGCTCCGGTCTACAGTGTGAGTGACGCAG
(16214038-16214139)