SNP details
ChrY position:18591943 (+strand)
Reference sequence (100bp): GGGACTTATACGCTCACATGCTTAGCCCTTTGGGAGGCTGAGATTAGAGG
 A 
TATCTTGAAGACAGGAGTGAAAGACCAGACTCACAACAAAACTGTCATCT
(18591892-18591993)