SNP details
ChrY position:19311571 (+strand)
Reference sequence (100bp): TGGGGAAACATAATTTCTGGGTGATTCTGAGAGGATGTTTCTGAAAGAGA
 T 
TAACATTTCAATCAGTAGACTAAGTGACGATCTGCCCTCTCCACTTGGGA
(19311520-19311621)