SNP details
ChrY position:21660572 (+strand)
Reference sequence (100bp): ATCCCAATCCTGGGATGTCAGAAAGATTTGTTTAGTTAAGTAAGGAAGTT
 C 
GGTTGAGCTTTCTCAGTAGAAGACACTCTGGCCAGAAACTAGCAGCCACC
(21660521-21660622)