SNP details
ChrY position:22081463 (+strand)
Reference sequence (100bp): TCAAGAGGAGCACAGCTTCCCAAGGCATTCAGAGCCCATTCACTGCAGTG
 G 
TGTTCCCATTATGTGGGAAATAAATTCAAAGGACATTATTTTGGAGTTTC
(22081412-22081513)