SNP details
ChrY position:7073204 (+strand)
Reference sequence (100bp): CCAGCACTTTGGGAGGTAGAGGTGGGAGGATACCCTGAACCTAGGGCAAC
 A 
TAGTGAGATCCCAGCTCTACAGAAAAGTTTTTAAAATTGGCCAGGCTTGA
(7073153-7073254)