SNP details
ChrY position:7084082 (+strand)
Reference sequence (100bp): AATCCCAGATACGCGGGAGGCTGAGGCAGGAGAATCACTTGAACTTGAGG
 G 
CACGGAGATTGCCATGAGTCAAGATAGCCCCATTGCACTCAAGCGTCAGT
(7084031-7084132)