SNP details
ChrY position:8589228 (+strand)
Reference sequence (100bp): CATGAAGACCCTGCTCGGCTGGGACCTGAATTCAAGGTAAATTCAAGGGC
 C 
CTTCATACAAGACTGCAAGTTTTCTTCCCTCAGTAGTCCACAGAACAATG
(8589177-8589278)